Stem-loop sequence cca-MIR6108a

AccessionMI0021094 (change log)
DescriptionCynara cardunculus miR6108a stem-loop
Gene family MIPF0001380; MIR6108
Literature search

1 open access papers mention cca-MIR6108a
(2 sentences)

Stem-loop
   uuaaugu               g     ag   c    --u   g   uaucuaaaacccacccaugaaucgcgguugauac 
5'        gagaagcguaagaag gaucu  acc uuga   cac uuu                                  g
          ||||||||||||||| |||||  ||| ||||   ||| |||                                   
3'        cucuucgcauucuuu cuaga  ugg aacu   gug aaa                                  u
   -------               a     ag   a    uac   g   ccuacucuacgugguucuacguagucuaauuagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108a

Accession MIMAT0024543
Sequence

7 - 

ugagaagcguaagaagggauc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).