Stem-loop sequence cca-MIR6108g

AccessionMI0021095 (change log)
DescriptionCynara cardunculus miR6108g stem-loop
Literature search

1 open access papers mention cca-MIR6108g
(2 sentences)

Stem-loop
   ---   au           ac     g a  c  c      u       u 
5'    ugg  gucccuucuua  cuucu a cg aa ccaacc caguuag u
      |||  |||||||||||  ||||| | || || |||||| |||||||  
3'    acc  uagggaagaau  gaaga u gc uu gguugg gucaauu g
   ccc   cc           gc     g g  c  a      -       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108g

Accession MIMAT0024544
Sequence

71 - 

ugagaagcguaagaagggauc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).