Stem-loop sequence cca-MIR6108b

AccessionMI0021096 (change log)
DescriptionCynara cardunculus miR6108b stem-loop
Gene family MIPF0001380; MIR6108
Literature search

1 open access papers mention cca-MIR6108b
(2 sentences)

Stem-loop
   uuacau       c              ag       aucacuuuuaauucagccccacccacgaauuguaguuaucacagaaauug 
5'       ugagaag guaagaagggaucu  acccuug                                                  a
         ||||||| ||||||||||||||  |||||||                                                  u
3'       auucuuc cauucuucccuaga  ugggaac                                                  c
   -----u       c              -g       ccaguuaggauaacuucuaguugugcuuaugccacguggcucuacgcggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108b

Accession MIMAT0024545
Sequence

7 - 

ugagaagcguaagaagggauc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).