Stem-loop sequence cca-MIR6110

AccessionMI0021098 (change log)
DescriptionCynara cardunculus miR6110 stem-loop
Literature search

1 open access papers mention cca-MIR6110
(1 sentences)

Stem-loop
   ca  c                             ucaauuuua        -----u     aguaa 
5'   ug ugaucuuguaacauuugaugaugugggug         ucauucau      uuugc     c
     || |||||||||||||||||||||||||||||         ||||||||      |||||      
3'   ac acuagaacauuguaaacuacugcaccuau         aguaagua      aaaug     c
   -g  a                             --------g        cucucc     auuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6110-5p

Accession MIMAT0024547
Sequence

8 - 

aucuuguaacauuugaugaugugg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cca-miR6110-3p

Accession MIMAT0024548
Sequence

91 - 

auccacgucaucaaauguuacaag

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).