Stem-loop sequence cca-MIR6111

AccessionMI0021099 (change log)
DescriptionCynara cardunculus miR6111 stem-loop
Literature search

1 open access papers mention cca-MIR6111
(2 sentences)

Stem-loop
   ---uu  a   c          g                 ac    uc             a     u         ag       a     a              ---ag     a         u  -c    a 
5'      gg gcu uuuaugucac auguaugacucuuuguu  uggu  caaaggauuauga gguag cuagcccac  acaacau aaugc uaucuugagacauc     uucac ugagacucg gc  ucca c
        || ||| |||||||||| |||||||||||||||||  ||||  ||||||||||||| ||||| |||||||||  ||||||| ||||| ||||||||||||||     ||||| ||||||||| ||  ||||  
3'      cc cga aaauauagug uacguacugaggaacaa  gcua  guuuccuaauacu cuauu gauugggug  uguugug uugug auagaacucuguag     gagug acucugagc ug  aggu a
   acaau  -   u          g                 -c    cu             a     c         cg       g     g              cccaa     c         u  uu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6111-5p

Accession MIMAT0024549
Sequence

8 - 

ucuuuaugucacgauguaugac

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cca-miR6111-3p

Accession MIMAT0024550
Sequence

239 - 

caugcauggugauauaaauagc

 - 260

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).