Stem-loop sequence cca-MIR6114

AccessionMI0021102 (change log)
DescriptionCynara cardunculus miR6114 stem-loop
Literature search

1 open access papers mention cca-MIR6114
(2 sentences)

Stem-loop
   -uau          a  c   a      ggaugcuuu     u   ga  u   c     uu 
5'     uggugaaagg au aug acguga         gguug guc  uu ucu gugua  u
       |||||||||| || ||| ||||||         ||||| |||  || ||| |||||   
3'     aucacuuucc ug uac ugcacu         ucaac cgg  aa aga cacau  c
   cguc          c  u   c      ---------     -   ag  u   a     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6114-5p

Accession MIMAT0024553
Sequence

7 - 

ugaaaggaaucaugaacguga

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cca-miR6114-3p

Accession MIMAT0024554
Sequence

88 - 

ucacguccauugucccuuuca

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).