Stem-loop sequence cca-MIR6108c

AccessionMI0021103 (change log)
DescriptionCynara cardunculus miR6108c stem-loop
Gene family MIPF0001380; MIR6108
Literature search

1 open access papers mention cca-MIR6108c
(2 sentences)

Stem-loop
   -a    u                  ga   guu   -   cuuuuaucucaaacccguucauuaacgcuugauacgag 
5'   guga aagcguaagaagagaucu  acc   gau cgc                                      g
     |||| ||||||||||||||||||  |||   ||| |||                                      a
3'   cacu uucguauucuucucuaga  ugg   cua gug                                      u
   uc    c                  gg   aac   c   uaauccaaucuacguggcgcuacucuacguaaccuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108c

Accession MIMAT0024555
Sequence

7 - 

aagcguaagaagagaucugaacc

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).