Stem-loop sequence cca-MIR6108d

AccessionMI0021104 (change log)
DescriptionCynara cardunculus miR6108d stem-loop
Gene family MIPF0001380; MIR6108
Literature search

1 open access papers mention cca-MIR6108d
(2 sentences)

Stem-loop
   cg     u        u    c                ga  caa    cuucgaugcaccuuaggaugagauguaucagaucaauccccgu 
5'   uguga aaggagag uaag ugagaagcguaagaag  au   uacu                                           a
     ||||| |||||||| |||| ||||||||||||||||  ||   ||||                                            
3'   acacu uuucucuc guuc acucuucgcauucuuc  ua   auga                                           u
   --     c        u    c                uc  aac    uaacuaguguaaauuagaguuugaguguguacuucgcgcgaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108d

Accession MIMAT0024556
Sequence

7 - 

auaaggagaguuaagcugagaagc

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).