Stem-loop sequence cca-MIR6108e

AccessionMI0021105 (change log)
DescriptionCynara cardunculus miR6108e stem-loop
Gene family MIPF0001380; MIR6108
Literature search

1 open access papers mention cca-MIR6108e
(2 sentences)

Stem-loop
       c               cc       g    aucuua   ga     aa     a   ggugcaacgagaugcaccaga 
5' agaa cguaagaagagaucu  acccuug auca      auu  auguc  cacua uga                     c
   |||| |||||||||||||||  ||||||| ||||      |||  |||||  ||||| |||                      
3' ucuu guauucuucucuaga  ugggaac uagu      uag  uacgg  guggu acu                     c
       c               cu       -    gaaaac   ag     --     -   uaaggcaaaaucuucccuaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108e-5p

Accession MIMAT0024557
Sequence

7 - 

guaagaagagaucuccacccuugg

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cca-miR6108e-3p

Accession MIMAT0024558
Sequence

132 - 

aucaaggguucagaucucuucuu

 - 154

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).