Stem-loop sequence cca-MIR6108f

AccessionMI0021106 (change log)
DescriptionCynara cardunculus miR6108f stem-loop
Gene family MIPF0001380; MIR6108
Literature search

1 open access papers mention cca-MIR6108f
(2 sentences)

Stem-loop
   --    g   u         g          aucuccacccuuggauaaauccuaauuggauaucaacacuaaugagaugcacua 
5'   ggaa uua ggugagaag guaagaaggg                                                      g
     |||| ||| ||||||||| ||||||||||                                                       
3'   ccuu aau ccacucuuc cauucuuccc                                                      a
   au    -   u         g          acuagugaaaauuagagugggguaggguacuuaacgcgaagaguacccuuaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR6108f

Accession MIMAT0024559
Sequence

7 - 

uauggugagaaggguaagaag

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).