Stem-loop sequence cca-MIR396c

AccessionMI0021108 (change log)
DescriptionCynara cardunculus miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention cca-MIR396c
(3 sentences)

Stem-loop
   -gc                             aaaaau       uuaauucc      a    u 
5'    cauguuuuuccacagcuuucuugaacuuu      ucaugug        guucuc agaa u
      |||||||||||||||||||||||||||||      |||||||        |||||| ||||  
3'    guacaaaagggugucgaaagaacuugaag      agugcac        uaagag uuuu c
   aca                             caaauu       -------u      c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cca-miR396c

Accession MIMAT0024561
Sequence

97 - 

uucaagaaagcugugggaaaa

 - 117

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22272770 "The miRNAome of globe artichoke: conserved and novel micro RNAs and target analysis" De Paola D, Cattonaro F, Pignone D, Sonnante G BMC Genomics. 13:41(2012).