Stem-loop sequence bta-mir-3120

AccessionMI0021116 (change log)
DescriptionBos taurus miR-3120 stem-loop
Gene family MIPF0000062; mir-214
Stem-loop
           a           ug c      a    ugag 
5' gucaugug cugccugucug  c ugcugu cagg    c
   |||||||| |||||||||||  | |||||| ||||    g
3' caguacac gacggacagau  g acgaca gucu    g
           a           gu a      c    ugua 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 40640371-40640451 [+]
antisense
ENSBTAT00000042265 ; bta-mir-214-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-3120
bta-mir-214chr16: 40640361-40640470 [-]
bta-mir-3120chr16: 40640371-40640451 [+]
bta-mir-199a-1chr16: 40646156-40646259 [-]
Database links

Mature sequence bta-miR-3120

Accession MIMAT0024572
Sequence

51 - 

cacagcaaguguagacaggca

 - 71

Get sequence
Deep sequencing18 reads, 8 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).