Stem-loop sequence mml-mir-378j

AccessionMI0021282 (change log)
DescriptionMacaca mulatta miR-378j stem-loop
Gene family MIPF0001463; mir-378_2
Literature search

1 open access papers mention mml-mir-378j
(2 sentences)

Stem-loop
   --------------------------------augcagugagug       aac     -          a 
5'                                             ggggagg   uggau uuggagccag a
                                               |||||||   ||||| |||||||||| g
3'                                             ucccuuc   aucua aaucuugguc a
   aaccacacaugauugaguauauuaggguuuaggguugagaugug       ---     u          a 
Get sequence
Deep sequencing
1036 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 43640938-43641046 [-]
antisense
ENSMMUT00000030054 ; CDK12-201; exon 14
Database links

Mature sequence mml-miR-378j

Accession MIMAT0024621
Sequence

21 - 

acuggauuuggagccagaa

 - 39

Get sequence
Deep sequencing1036 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).