Stem-loop sequence osa-MIR6253

Accession

MI0021603 (change log)

Description

Oryza sativa miR6253 stem-loop

Literature search

3 open access papers mention osa-MIR6253
(5 sentences)

Stem-loop

   aua  -   u            gca      uu    uu 
5'    uc aau agaggaaagugg   guuggg  aagc  a
      || ||| ||||||||||||   ||||||  ||||  u
3'    ag uua ucuccuuuuacu   caaccu  uuug  u
   ucc  a   c            -aa      cu    uc 

Deep sequencing

19 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr7: 25019014-25019092 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR6253

• osa-MIR6253: Chr7: 25019014-25019092 [-]
• osa-MIR6255: Chr7: 25018786-25018870 [-]

Database links

• miRBase Tracker:MI0021603

Mature sequence osa-miR6253

• Accession: MIMAT0024876
• Sequence: 11 - gaggaaagugggcaguuggguu - 32
• Deep sequencing: 18 reads, 2 experiments
• Evidence: experimental; Illumina [1]

References

1. PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).