Stem-loop ppe-MIR398b

Accession

MI0021665

Description

Prunus persica ppe-MIR398b precursor miRNA

Gene family

MIPF0000107; MIR398

Literature search

5 open access papers mention ppe-MIR398b
(11 sentences)

Sequence

uggagccccacaggggugaccugagaucacauguauguggcaacagcagaacccaagagggccaucguucgguccugcuguucuuugcauuccaCGUGUUCUCAGGUCGCCCCUGcagggcuuuc
.(((((((..((((((((((((((((.(((.((.((((((.((((((((.(((...((......))....))).))))))))))..))))..)).))).))))))))))))))))..))))))).

Structure

u       ca                u   a  -u    --  c        a   -caa  gg 
 ggagccc  caggggugaccugaga cac ug  augu  gg aacagcag acc    ga  g
 |||||||  |||||||||||||||| ||| ||  ||||  || |||||||| |||    ||   
 uuucggg  GUCCCCGCUGGACUCU GUG ac  uacg  uc uugucguc ugg    cu  c
c       ac                U   C  cu    uu  -        c   cuug  ac 

Annotation confidence Not enough data

Comments

Gao et al. identified small RNAs by sequencing in Prunus mume [1]. The reads were mapped to the Prunus persica genome. This entry represents the Prunus persica sequence, but the evidence for mature RNA expression is from Prunus mume.

Genome context

chrG4: 19261810-19261934 [-]

Mature ppe-miR398b

• Accession: MIMAT0027328
• Description: Prunus persica ppe-miR398b mature miRNA
• Sequence: 95 - CGUGUUCUCAGGUCGCCCCUG - 115
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 22863067
   High-throughput sequencing of small RNAs and analysis of differentially expressed microRNAs associated with pistil development in Japanese apricot
   Gao Z, Shi T, Luo X, Zhang Z, Zhuang W, Wang L
   BMC Genomics (2012) 13:371