Stem-loop sequence gma-MIR390d

AccessionMI0021700 (change log)
DescriptionGlycine max miR390d stem-loop
Gene family MIPF0000101; MIR390
Literature search

19 open access papers mention gma-MIR390d
(69 sentences)

Stem-loop
   g    u    a          g       a   ----  a     --   a 
5'  agaa cugu aagcucagga ggauagc cca    ug uacug  aug u
    |||| |||| |||||||||| ||||||| |||    || |||||  ||| g
3'  ucuu ggua uucgaguucu ucuaucg ggu    ac augac  uac u
   -    c    c          a       c   ucaa  -     ga   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 41878692-41878788 [+]
intergenic
Database links

Mature sequence gma-miR390d

Accession MIMAT0024906
Sequence

12 - 

aagcucaggagggauagcacc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).