Stem-loop sequence gma-MIR390e

AccessionMI0021701 (change log)
DescriptionGlycine max miR390e stem-loop
Gene family MIPF0000101; MIR390
Literature search

19 open access papers mention gma-MIR390e
(74 sentences)

Stem-loop
   g     u ug a          -   a      cau        uu  --u     uu     ua 
5'  aagaa u  u aagcucagga ggg uagcgc   ggaagguc  uc   acuaa  ugcuc  u
    ||||| |  | |||||||||| ||| ||||||   ||||||||  ||   |||||  |||||   
3'  uucuu g  a uuugaguccu ccc aucgcg   ucuucuag  ag   ugguu  guggg  c
   -     u gu c          a   -      auc        cu  cuu     uc     ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 49001211-49001337 [+]
intergenic
Database links

Mature sequence gma-miR390e

Accession MIMAT0024907
Sequence

14 - 

agcucaggagggauagcgcc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).