Stem-loop sequence gma-MIR390f

AccessionMI0021702 (change log)
DescriptionGlycine max miR390f stem-loop
Gene family MIPF0000101; MIR390
Literature search

19 open access papers mention gma-MIR390f
(69 sentences)

Stem-loop
   --------         a          g           caacacuc     u 
5'         agaaucugu aagcucagga ggauagcgcca        augau u
           ||||||||| |||||||||| |||||||||||        ||||| u
3'         ucuugggca uuugaguccu ucuaucgcggu        uacua a
   ggcauucu         c          a           uuauauaa     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 15535991-15536093 [-]
intergenic
Database links

Mature sequence gma-miR390f

Accession MIMAT0024908
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).