Stem-loop sequence gma-MIR390g

AccessionMI0021703 (change log)
DescriptionGlycine max miR390g stem-loop
Gene family MIPF0000101; MIR390
Literature search

19 open access papers mention gma-MIR390g
(69 sentences)

Stem-loop
   ------------      a          g           -cg     c     uu 
5'             aucugu aagcucagga ggauagcgcca   acacu augau  u
               |||||| |||||||||| |||||||||||   ||||| |||||   
3'             ugggca uuugaguccu ucuaucgcggu   uguga uacua  c
   ugucauucuuuu      c          a           uua     -     ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 5065776-5065877 [-]
intergenic
Database links

Mature sequence gma-miR390g

Accession MIMAT0024909
Sequence

8 - 

aagcucaggagggauagcgcc

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).