Stem-loop sequence gma-MIR393c

AccessionMI0021704 (change log)
DescriptionGlycine max miR393c stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393c
(49 sentences)

Stem-loop
   g       c            c    u          -uuc   uuuauaaauuuuu 
5'  gaggagg auccaaagggau gcau gaucccaaau    aga             c
    ||||||| |||||||||||| |||| ||||||||||    |||              
3'  uuccucc uagguuucccua cgua cuaggguuua    ucu             u
   -       u            u    -          uaac   uccccucccuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 44047954-44048066 [-]
intergenic
Database links

Mature sequence gma-miR393c-5p

Accession MIMAT0024910
Previous IDsgma-miR393c
Sequence

11 - 

uccaaagggaucgcauugaucc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence gma-miR393c-3p

Accession MIMAT0032134
Sequence

86 - 

aucaugcuaucccuuuggauu

 - 106

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).
2