Stem-loop sequence gma-MIR393d

AccessionMI0021705 (change log)
DescriptionGlycine max miR393d stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393d
(49 sentences)

Stem-loop
   c         c            c    u         uccaagcuucaauguucuucuau 
5'  uagaggagg auccaaagggau gcau gaucccaaa                       c
    ||||||||| |||||||||||| |||| |||||||||                       u
3'  auuuccucu uagguuucccua cgua cuaggguuu                       u
   -         u            u    -         auuuuaauuauaaaacucacucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 25990586-25990708 [-]
intergenic
Database links

Mature sequence gma-miR393d

Accession MIMAT0024911
Sequence

13 - 

uccaaagggaucgcauugaucc

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).