Stem-loop sequence gma-MIR393e

AccessionMI0021706 (change log)
DescriptionGlycine max miR393e stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393e
(49 sentences)

Stem-loop
   g       c            c    u          uucagauuuauaaauuugucuuucucuucccuu 
5'  gaggagg auccaaagggau gcau gaucccaaau                                 g
    ||||||| |||||||||||| |||| ||||||||||                                 u
3'  uuccucc uagguuucccua cgua cuaggguuua                                 c
   -       u            u    -          uaacucuucccuucucuuuacuaggguuuauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 5137829-5137969 [+]
intergenic
Database links

Mature sequence gma-miR393e

Accession MIMAT0024912
Sequence

11 - 

uccaaagggaucgcauugaucc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).