Stem-loop sequence gma-MIR393f

AccessionMI0021707 (change log)
DescriptionGlycine max miR393f stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393f
(49 sentences)

Stem-loop
   g       c            c    u          ccaagcu        uuucucucu 
5'  gaggagg auccaaagggau gcau gaucccaaau       uuaauauu         u
    ||||||| |||||||||||| |||| ||||||||||       ||||||||          
3'  uuccucu uagguuucccua cgua cuaggguuua       aauuauaa         c
   -       u            u    -          ----uuu        uaacucacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 2419300-2419417 [-]
intergenic
Database links

Mature sequence gma-miR393f

Accession MIMAT0024913
Sequence

11 - 

uccaaagggaucgcauugaucc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).