Stem-loop sequence gma-MIR393g

AccessionMI0021708 (change log)
DescriptionGlycine max miR393g stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393g
(49 sentences)

Stem-loop
   a                    c    u         uccaagcuucaauguucuucucu 
5'  gaggaggcauccaaagggau gcau gaucccaaa                       c
    |||||||||||||||||||| |||| |||||||||                       u
3'  uuccucuguagguuucccua cgua cuaggguuu                       u
   -                    u    -         auuuuaauuguaaaacucacucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 26105756-26105874 [-]
intergenic
Database links

Mature sequence gma-miR393g

Accession MIMAT0024914
Sequence

11 - 

uccaaagggaucgcauugaucc

 - 32

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).