Stem-loop sequence gma-MIR393h

AccessionMI0021709 (change log)
DescriptionGlycine max miR393h stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393h
(49 sentences)

Stem-loop
   ugug             a            u        ucuuguagauguuuacacuugcaagcuuugcaug 
5'     gguggagaguucc aagggaucgcau gaucuaau                                  c
       ||||||||||||| |||||||||||| ||||||||                                  a
3'     cuaccuuucaagg uucccuagcgua cuagguua                                  a
   -caa             a            -        uucacuuggugacuuaguguagacuuagguccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 34250214-34250360 [+]
intergenic
Database links

Mature sequence gma-miR393h

Accession MIMAT0024915
Sequence

14 - 

uuccaaagggaucgcauugauc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).