Stem-loop sequence gma-MIR393i

AccessionMI0021710 (change log)
DescriptionGlycine max miR393i stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393i
(52 sentences)

Stem-loop
   guu      u      a            u       u  uuuaucuuccugcauguauuuacuugcag 
5'    ggugga aguucc aagggaucgcau gaucuaa uc                             c
      |||||| |||||| |||||||||||| ||||||| ||                              
3'    cuaccu uuaagg uucccuagcgua cuagguu ag                             u
   -cg      u      a            -       c  ucacuuggccauuuuuccagguuuugguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 46430313-46430450 [+]
intergenic
Database links

Mature sequence gma-miR393i

Accession MIMAT0024916
Sequence

13 - 

uuccaaagggaucgcauugauc

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).