Stem-loop sequence gma-MIR393j

AccessionMI0021711 (change log)
DescriptionGlycine max miR393j stem-loop
Gene family MIPF0000083; MIR393
Literature search

22 open access papers mention gma-MIR393j
(50 sentences)

Stem-loop
   ugug             a            u        uc   ua   g   gaacuu    u         ugcaug 
5'     gguggagaguucc aagggaucgcau gaucuaau  uug  gau ccu      gcaa cuugaaucu      c
       ||||||||||||| |||||||||||| ||||||||  |||  ||| |||      |||| |||||||||       
3'     cuaccuuucaagg uucccuagcgua cuagguua  gac  uug gga      cguu ggauuuagg      a
   -uaa             a            -        uu   --   g   --auuu    u         uccuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 34388224-34388377 [+]
intergenic
Database links

Mature sequence gma-miR393j

Accession MIMAT0024917
Sequence

14 - 

uuccaaagggaucgcauugauc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).