Stem-loop sequence gma-MIR393k

AccessionMI0021712 (change log)
DescriptionGlycine max miR393k stem-loop
Gene family MIPF0000083; MIR393
Literature search

21 open access papers mention gma-MIR393k
(50 sentences)

Stem-loop
   uguu             a            u       u  uugaucuuccugcaugcauuugcuugcagu 
5'     gguggagaguucc aagggaucgcau gaucuaa uc                              u
       ||||||||||||| |||||||||||| ||||||| ||                               
3'     cuaccucuuaagg uucccuagcgua cuagguu ag                              c
   -ccg             a            -       c  ucacuuggccauuuuauaccgaguuuucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 39779945-39780086 [-]
intergenic
Database links

Mature sequence gma-miR393k

Accession MIMAT0024918
Sequence

14 - 

uuccaaagggaucgcauugauc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).