Stem-loop sequence gma-MIR1515b

AccessionMI0021720 (change log)
DescriptionGlycine max miR1515b stem-loop
Gene family MIPF0001591; MIR1515
Literature search

10 open access papers mention gma-MIR1515b
(19 sentences)

Stem-loop
   -----  uu              c       u   c       auucccuguaccguuguuucguucuggcau 
5'      ug  caucauuuugcgug aaugauc gaa cauuuuc                              a
        ||  |||||||||||||| ||||||| ||| |||||||                               
3'      ac  guaguaaaacgcac uuacuag cuu guaaaag                              a
   uuuua  -u              -       u   u       guguuugguuuuuuguuacuggauuaaacc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 6656792-6656932 [-]
intergenic
Database links

Mature sequence gma-miR1515b

Accession MIMAT0024926
Sequence

7 - 

ucauuuugcgugcaaugaucug

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).