Stem-loop sequence gma-MIR1516d

AccessionMI0021721 (change log)
DescriptionGlycine max miR1516d stem-loop
Literature search

1 open access papers mention gma-MIR1516d
(1 sentences)

Stem-loop
   ---             a  g              a   c     caaaaaaagu 
5'    guuuggauacaag ua aagugcuuuugaga cuu ucuau          u
      ||||||||||||| || |||||||||||||| ||| |||||           
3'    caaaccuauguuc gu uucaugaaaacucu gaa agaua          c
   uaa             g  g              a   a     aucuuuauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 46223096-46223202 [-]
intergenic
Database links

Mature sequence gma-miR1516d

Accession MIMAT0024927
Sequence

82 - 

guacuuguggcuuguauccaa

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).