Stem-loop sequence gma-MIR6299

AccessionMI0021723 (change log)
DescriptionGlycine max miR6299 stem-loop
Stem-loop
   a        cg       c  u             c  c      uuu 
5'  aauauuga  ugacaaa ca uaauuuuaaauua ua uuuguu   g
    ||||||||  ||||||| || ||||||||||||| || ||||||    
3'  uugugacu  acuguuu gu auuaaaauuuaau au aaauag   a
   -        au       a  u             a  a      ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 12107873-12107969 [+]
intergenic
Database links

Mature sequence gma-miR6299

Accession MIMAT0024928
Sequence

66 - 

auuuaaaauuauugauuuguca

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).