Stem-loop sequence gma-MIR6300

AccessionMI0021724 (change log)
DescriptionGlycine max miR6300 stem-loop
Stem-loop
   a   aaa                       a     uuu    aau  aau      u    auaauaaauguuuuaauauuaccgauagcauuugauuauauuuuuguuuuaaaguuacauuugau 
5'  ggu   aauacuuaccacuauauuacaac acuug   guga   uc   gguaau uuaa                                                                 u
    |||   ||||||||||||||||||||||| |||||   ||||   ||   |||||| ||||                                                                 a
3'  ccg   uuaugaauggugauaugauguug ugaac   uacu   ag   ucauua aauu                                                                 u
   -   ccc                       c     ---    aau  --c      u    auauagauauguuuuuucaacguacuauaaccuacuuauacugaauguaauaucggcuaucgcua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 3181460-3181710 [-]
intergenic
Database links

Mature sequence gma-miR6300

Accession MIMAT0024929
Sequence

220 - 

gucguuguaguauagugg

 - 237

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).