Stem-loop sequence hsv1-mir-H26

AccessionMI0021816 (change log)
DescriptionHerpes Simplex Virus 1 miR-H26 stem-loop
Stem-loop
   u     u   g   --  -g  cu    u   u 
5'  caggc agc cgg  cg  gc  gccg agu u
    ||||| ||| |||  ||  ||  |||| ||| c
3'  guucg uug gcc  gc  cg  uggc ucg u
   g     -   -   ug  ag  ag    -   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv1-miR-H26

Accession MIMAT0025022
Sequence

33 - 

uggcucggugagcgacgguc

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1