Stem-loop sequence sma-mir-10

Accession

MI0021817 (change log)

Description

Schistosoma mansoni miR-10 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

3 open access papers mention sma-mir-10
(6 sentences)

Stem-loop

   --  uc     -gaa  c       c        g  gca 
5'   cc  aguau    cc uguagac cgaguuug au   g
     ||  |||||    || ||||||| |||||||| ||    
3'   gg  ucaua    gg auaucug gcuuaaac ua   u
   aa  uu     aaaa  a       a        g  gac 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (WTSI5): Chr_4: 19959268-19959346 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0021817

Mature sequence sma-miR-10-5p

• Accession: MIMAT0025023
• Sequence: 11 - aacccuguagacccgaguuugg - 32
• Evidence: experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-10-3p

• Accession: MIMAT0025024
• Sequence: 47 - aaauucgagucuauaaggaaaaa - 69
• Evidence: experimental; Illumina [2], SOLiD [2]

References

1. PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2. PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).