Stem-loop sequence sma-mir-10

AccessionMI0021817 (change log)
DescriptionSchistosoma mansoni miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention sma-mir-10
(6 sentences)

Stem-loop
   --  uc     -gaa  c       c        g  gca 
5'   cc  aguau    cc uguagac cgaguuug au   g
     ||  |||||    || ||||||| |||||||| ||    
3'   gg  ucaua    gg auaucug gcuuaaac ua   u
   aa  uu     aaaa  a       a        g  gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_4: 19959268-19959346 [-]
intergenic
Database links

Mature sequence sma-miR-10-5p

Accession MIMAT0025023
Sequence

11 - 

aacccuguagacccgaguuugg

 - 32

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-10-3p

Accession MIMAT0025024
Sequence

47 - 

aaauucgagucuauaaggaaaaa

 - 69

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).