Stem-loop sequence sma-mir-2a

AccessionMI0021820 (change log)
DescriptionSchistosoma mansoni miR-2a stem-loop
Gene family MIPF0001838; mir-2_2
Literature search

5 open access papers mention sma-mir-2a
(14 sentences)

Stem-loop
   a   c        -ca              aa    uug 
5'  ccu uugcgccg   gucaauauuggcug  ggca   c
    ||| ||||||||   ||||||||||||||  ||||   u
3'  gga aauguggc   uaguuaugaccgac  cugu   u
   -   a        aag              -a    uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 22875749-22875826 [+]
intergenic
Clustered miRNAs
< 10kb from sma-mir-2a
sma-mir-71aChr_W: 22875654-22875735 [+]
sma-mir-2aChr_W: 22875749-22875826 [+]
sma-mir-2bChr_W: 22875844-22875922 [+]
sma-mir-2eChr_W: 22875945-22876027 [+]
Database links

Mature sequence sma-miR-2a-5p

Accession MIMAT0025029
Sequence

14 - 

cagucaauauuggcugaaggca

 - 35

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-2a-3p

Accession MIMAT0025030
Sequence

47 - 

ucacagccaguauugaugaacg

 - 68

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).