Stem-loop sequence sma-mir-2b

AccessionMI0021821 (change log)
DescriptionSchistosoma mansoni miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

4 open access papers mention sma-mir-2b
(11 sentences)

Stem-loop
   --      u  - c      ---    a      a   ucgu 
5'   aggugg gc g gucuca   aggg cuguga aca    a
     |||||| || | ||||||   |||| |||||| |||    a
3'   uccauc cg c cagggu   uccc gacacu ugu    c
   cg      -  a a      ucg    -      a   uuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 22875844-22875922 [+]
intergenic
Clustered miRNAs
< 10kb from sma-mir-2b
sma-mir-71aChr_W: 22875654-22875735 [+]
sma-mir-2aChr_W: 22875749-22875826 [+]
sma-mir-2bChr_W: 22875844-22875922 [+]
sma-mir-2eChr_W: 22875945-22876027 [+]
Database links

Mature sequence sma-miR-2b-5p

Accession MIMAT0025031
Sequence

11 - 

cgucucaagggacugugaaaca

 - 32

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-2b-3p

Accession MIMAT0025032
Sequence

46 - 

uaucacagcccugcuugggacaca

 - 69

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).