Stem-loop sequence sma-mir-2c

AccessionMI0021822 (change log)
DescriptionSchistosoma mansoni miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

4 open access papers mention sma-mir-2c
(12 sentences)

Stem-loop
   ----    cau      --uu  a          uucga 
5'     ggcg   cccuug    cg cugugaugug     a
       ||||   ||||||    || ||||||||||     g
3'     cugc   gggaau    gc gacacuauac     u
   aaaa    uuc      ucgu  c          ucaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_5: 1982423-1982497 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-2c
sma-mir-71bChr_5: 1982759-1982850 [-]
sma-mir-2fChr_5: 1982640-1982726 [-]
sma-mir-2dChr_5: 1982526-1982613 [-]
sma-mir-2cChr_5: 1982423-1982497 [-]
Database links

Mature sequence sma-miR-2c-5p

Accession MIMAT0025033
Sequence

7 - 

ucccuuguucgacugugaugug

 - 28

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-2c-3p

Accession MIMAT0025034
Sequence

44 - 

uaucacagccgugcuuaagggc

 - 65

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).