Stem-loop sequence sma-mir-2e

Accession

MI0021824 (change log)

Description

Schistosoma mansoni miR-2e stem-loop

Gene family

MIPF0000049; mir-2

Literature search

4 open access papers mention sma-mir-2e
(10 sentences)

Stem-loop

   ---------gcu        --   u     a u     --u    u 
5'             cuuaccaa  cuu gacug g uauac   gcuu u
               ||||||||  ||| ||||| | |||||   ||||  
3'             gaaugguu  gaa cugac c auaug   cgaa g
   uugggugguuuu        uc   c     a u     uuc    u 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (WTSI5): Chr_W: 22875945-22876027 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from sma-mir-2e

• sma-mir-71a: Chr_W: 22875654-22875735 [+]
• sma-mir-2a: Chr_W: 22875749-22875826 [+]
• sma-mir-2b: Chr_W: 22875844-22875922 [+]
• sma-mir-2e: Chr_W: 22875945-22876027 [+]

Database links

• miRBase Tracker:MI0021824

Mature sequence sma-miR-2e-5p

• Accession: MIMAT0025036
• Sequence: 6 - uaccaacuuugacugaguuau - 26
• Evidence: experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-2e-3p

• Accession: MIMAT0025037
• Sequence: 48 - uaucacaguccaagcuuuggu - 68
• Evidence: experimental; Illumina [2], SOLiD [2]

References

1. PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2. PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).