Stem-loop sequence sma-mir-2e

AccessionMI0021824 (change log)
DescriptionSchistosoma mansoni miR-2e stem-loop
Gene family MIPF0000049; mir-2
Literature search

4 open access papers mention sma-mir-2e
(10 sentences)

Stem-loop
   ---------gcu        --   u     a u     --u    u 
5'             cuuaccaa  cuu gacug g uauac   gcuu u
               ||||||||  ||| ||||| | |||||   ||||  
3'             gaaugguu  gaa cugac c auaug   cgaa g
   uugggugguuuu        uc   c     a u     uuc    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 22875945-22876027 [+]
intergenic
Clustered miRNAs
< 10kb from sma-mir-2e
sma-mir-71aChr_W: 22875654-22875735 [+]
sma-mir-2aChr_W: 22875749-22875826 [+]
sma-mir-2bChr_W: 22875844-22875922 [+]
sma-mir-2eChr_W: 22875945-22876027 [+]
Database links

Mature sequence sma-miR-2e-5p

Accession MIMAT0025036
Sequence

6 - 

uaccaacuuugacugaguuau

 - 26

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-2e-3p

Accession MIMAT0025037
Sequence

48 - 

uaucacaguccaagcuuuggu

 - 68

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).