Stem-loop sequence sma-mir-71b

AccessionMI0021830 (change log)
DescriptionSchistosoma mansoni miR-71b stem-loop
Gene family MIPF0000278; mir-71
Literature search

7 open access papers mention sma-mir-71b
(25 sentences)

Stem-loop
   -  -  uu   au         g    g    a    uac  cgu  uu 
5'  cc gu  gcc  gaaagacuu agua ugag cgcu   ag   gg  u
    || ||  |||  ||||||||| |||| |||| ||||   ||   ||   
3'  gg ca  cgg  cuuucugag ucau acuc gcgg   uc   cc  u
   c  u  cu   cc         -    -    c    -cu  ---  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_5: 1982759-1982850 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-71b
sma-mir-71bChr_5: 1982759-1982850 [-]
sma-mir-2fChr_5: 1982640-1982726 [-]
sma-mir-2dChr_5: 1982526-1982613 [-]
sma-mir-2cChr_5: 1982423-1982497 [-]
Database links

Mature sequence sma-miR-71b-5p

Accession MIMAT0025043
Sequence

11 - 

ugaaagacuugaguagugagacg

 - 33

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-71b-3p

Accession MIMAT0025044
Sequence

62 - 

ccucauacugagucuuucccg

 - 82

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).