Stem-loop sequence rno-mir-6324

AccessionMI0021848 (change log)
DescriptionRattus norvegicus miR-6324 stem-loop
Literature search

1 open access papers mention rno-mir-6324
(3 sentences)

Stem-loop 
   u  aa   -cc    a   ---     c        c     a   -     g    ---g     
5'  gg  uca   agau gcu   ggggu aaggugcu ugcug cug ccuau ggcu    uggg 
    ||  |||   |||| |||   ||||| |||||||| ||||| ||| ||||| ||||    ||| a
3'  cc  agu   uuua cga   cccua uuccacga acgac gac ggaug cuga    accu 
   u  -c   cac    a   guu     u        -     a   c     a    guca
Get sequence
Deep sequencing
22539 reads, 2.47 reads per million, 486 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr11: 36383529-36383649 [-]
sense
ENSRNOT00000002231 ; Brwd1-201; intron 21
Database links

Mature sequence rno-miR-6324

Accession MIMAT0025063
Sequence

69 -  

ucaguaggccagacagcaagcac

 - 91

Get sequence
Deep sequencing4028 reads, 398 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).