Stem-loop sequence rno-mir-6331

AccessionMI0021855 (change log)
DescriptionRattus norvegicus miR-6331 stem-loop
Stem-loop
   cucaca  gacaacu       -----         --uuu    gc     u   u   -   gg 
5'       cc       uugaggu     ggcaacagc     ggug  uuagu cuu gug cuu  u
         ||       |||||||     |||||||||     ||||  ||||| ||| ||| |||  u
3'       gg       aauucua     ucguuguug     ccac  aauca gag cac gag  u
   --ucaa  -agaccu       aauug         ucugu    uc     -   u   a   gg 
Get sequence
Deep sequencing
291731 reads, 201 reads per million, 430 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133878578-133878700 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-6331
rno-mir-667chr6: 133869570-133869661 [+]
rno-mir-376cchr6: 133872439-133872522 [+]
rno-mir-376bchr6: 133873095-133873180 [+]
rno-mir-3595chr6: 133873587-133873706 [-]
rno-mir-376achr6: 133873605-133873686 [+]
rno-mir-300chr6: 133874152-133874230 [+]
rno-mir-381chr6: 133876615-133876675 [+]
rno-mir-487bchr6: 133877124-133877205 [+]
rno-mir-3576chr6: 133877812-133877926 [-]
rno-mir-539chr6: 133877832-133877907 [+]
rno-mir-6331chr6: 133878578-133878700 [+]
rno-mir-544chr6: 133879169-133879246 [+]
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
Database links

Mature sequence rno-miR-6331

Accession MIMAT0025070
Sequence

31 - 

cuuugguggcuuaguucuuugugc

 - 54

Get sequence
Deep sequencing19754 reads, 299 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).