Stem-loop sequence rno-mir-3072

AccessionMI0021856 (change log)
DescriptionRattus norvegicus miR-3072 stem-loop
Gene family MIPF0001410; mir-3072
Literature search

1 open access papers mention rno-mir-3072
(1 sentences)

Stem-loop 
   cca   ag   - ca      u     u     -ac  c ag  a       cu     
5'    aga  gug g  gggcug gagug gaggg   cc g  gg gggcagg  gccc 
      |||  ||| |  |||||| ||||| |||||   || |  || |||||||  ||| c
3'    ucu  cac c  cccgac cucgu cuucc   gg c  cc cccgucc  cgga 
   aac   ag   a ac      -     u     gaa  a cu  -       --
Get sequence
Deep sequencing
534 reads, 0 reads per million, 118 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133898795-133898905 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-3072
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-3072chr6: 133898795-133898905 [+]
Database links

Mature sequence rno-miR-3072

Accession MIMAT0025071
Sequence

64 -  

ugcccccuccaggaagccuucuu

 - 86

Get sequence
Deep sequencing480 reads, 110 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22605339 "Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum" Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T J Biol Chem. 287:24397-24411(2012).
2
PMID:22908386 "MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase" Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC J Biol Chem. 287:25312-25324(2012).