![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-3072 |
||||||||||||||||||||||
Accession | MI0021856 (change log) | |||||||||||||||||||||
Description | Rattus norvegicus miR-3072 stem-loop | |||||||||||||||||||||
Gene family | MIPF0001410; mir-3072 | |||||||||||||||||||||
Literature search |
1 open access papers mention rno-mir-3072 | |||||||||||||||||||||
Stem-loop |
cca ag - ca u u -ac c ag a cu 5' aga gug g gggcug gagug gaggg cc g gg gggcagg gccc ||| ||| | |||||| ||||| ||||| || | || ||||||| ||| c 3' ucu cac c cccgac cucgu cuucc gg c cc cccgucc cgga aac ag a ac - u gaa a cu - -- |
|||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||
Database links |
|
Mature sequence rno-miR-3072 |
|
Accession | MIMAT0025071 |
Sequence |
64 - ugcccccuccaggaagccuucuu - 86 |
Deep sequencing | 480 reads, 110 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:22605339
"Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum"
J Biol Chem. 287:24397-24411(2012).
|
2 |
PMID:22908386
"MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase"
J Biol Chem. 287:25312-25324(2012).
|