Stem-loop sequence mmu-mir-6412

AccessionMI0021949 (change log)
Symbol MGI:Mir6412
DescriptionMus musculus miR-6412 stem-loop
Literature search

1 open access papers mention mmu-mir-6412
(24 sentences)

Stem-loop
   -c    u    u  -u     ac  c       -ua    cagg    u  a 
5'   uagu agcu ga  guggu  ug acuccua   aucc    gucu gg g
     |||| |||| ||  |||||  || |||||||   ||||    |||| ||  
3'   auca ucga cu  uacca  gc ugaggau   uagg    cgga uc g
   ua    -    -  cc     aa  u       uag    ---a    -  u 
Get sequence
Deep sequencing
6045 reads, 55.1 reads per million, 98 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 122648339-122648435 [+]
intergenic
Database links

Mature sequence mmu-miR-6412

Accession MIMAT0025165
Sequence

74 - 

ucgaaaccauccucagcuacua

 - 95

Get sequence
Deep sequencing6017 reads, 97 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).