Stem-loop sequence ssc-let-7f-2

AccessionMI0022121 (change log)
DescriptionSus scrofa let-7f-2 stem-loop
Gene family MIPF0000002; let-7
Literature search

46 open access papers mention ssc-let-7f-2
(226 sentences)

Stem-loop
   ---   a    a ug                      ---------       u 
5'    ucu ucag g  agguaguagauuguauaguugu         gggguag g
      ||| |||| |  ||||||||||||||||||||||         ||||||| a
3'    agg aguc c  uccguuaucuaacauaucaaua         ucccauu u
   aug   -    - cu                      gaggacuug       u 
Get sequence
Deep sequencing
61766 reads, 1.94e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 44864800-44864896 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-let-7f-2
ssc-let-7a-2chr3: 44864433-44864524 [+]
ssc-let-7f-2chr3: 44864800-44864896 [+]
ssc-let-7dchr3: 44867267-44867362 [+]
Database links

Mature sequence ssc-let-7f-5p

Accession MIMAT0002152
Sequence

11 - 

ugagguaguagauuguauaguu

 - 32

Get sequence
Deep sequencing153350 reads, 15 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-let-7f-3p

Accession MIMAT0037464
Sequence

67 - 

cuauacaaucuauugccuucc

 - 87

Get sequence
Deep sequencing39 reads, 9 experiments
Evidence experimental; Illumina [3]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
3
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).