Stem-loop sequence ssc-mir-150-1

AccessionMI0022133 (change log)
DescriptionSus scrofa miR-150-1 stem-loop
Gene family MIPF0000197; mir-150
Literature search

10 open access papers mention ssc-mir-150-1
(27 sentences)

Stem-loop
   -   -  -    au      ac   u       -u  gug 
5'  cuc gg cccu  cuccca  ccu guaccag  gc   c
    ||| || ||||  ||||||  ||| |||||||  ||    
3'  ggg cc ggga  gggggu  gga caugguc  ug   c
   g   u  a    cg      aa   -       cc  acu 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 50309879-50309955 [-]
sense
ENSSSCT00000029075 ; ssc-mir-150-2.1-201; exon 1
antisense
ENSSSCT00000003515 ; RPS11-201; exon 5
ENSSSCT00000003516 ; RPL13A-201; intron 8
Database links

Mature sequence ssc-miR-150

Accession MIMAT0025365
Sequence

11 - 

ucucccaacccuuguaccagug

 - 32

Get sequence
Deep sequencing112 reads, 12 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).