Stem-loop sequence ssc-mir-190a

AccessionMI0022136 (change log)
DescriptionSus scrofa miR-190a stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention ssc-mir-190a
(1 sentences)

Stem-loop
   -   ---- u    - ug               ua     uuau 
5'  ggc    c cugu g  auauguuugauauau  gguug    u
    |||    | |||| |  |||||||||||||||  |||||     
3'  ccg    g gaca c  uauacaaacuauaua  ucaac    u
   c   uucu u    u cu               --     cuaa 
Get sequence
Deep sequencing
918 reads, 80 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 120448012-120448093 [-]
sense
ENSSSCT00000020139 ; ssc-mir-190a.1-201; exon 1
Database links

Mature sequence ssc-miR-190a

Accession MIMAT0025367
Sequence

11 - 

ugauauguuugauauauuagg

 - 31

Get sequence
Deep sequencing913 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).