Stem-loop sequence ssc-mir-212

AccessionMI0022140 (change log)
DescriptionSus scrofa miR-212 stem-loop
Gene family MIPF0000065; mir-132
Literature search

3 open access papers mention ssc-mir-212
(8 sentences)

Stem-loop
   -gc   c   -ca  u     cu      c      ccc     
5'    gcg cgg   cc uggcu  agacug uuacug   gggc 
      ||| |||   || |||||  |||||| ||||||   ||| c
3'    cgc gcc   gg acuga  ucugac aaugac   cccg 
   guc   a   acc  c     cc      -      --u     
Get sequence
Deep sequencing
35 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 50016151-50016232 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-212
ssc-mir-212chr12: 50016151-50016232 [-]
ssc-mir-132chr12: 50015722-50015799 [-]
Database links

Mature sequence ssc-miR-212

Accession MIMAT0025370
Sequence

11 - 

accuuggcucuagacugcuuacu

 - 33

Get sequence
Deep sequencing22 reads, 9 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).