Stem-loop sequence ssc-mir-489

AccessionMI0022150 (change log)
DescriptionSus scrofa miR-489 stem-loop
Gene family MIPF0000111; mir-489
Literature search

2 open access papers mention ssc-mir-489
(5 sentences)

Stem-loop
   u     c     g            gc c  u  a     g 
5'  ggcag uuggu gucguaugugug  g ca cu cuuga c
    ||||| ||||| ||||||||||||  | || || |||||  
3'  ucguc aaucg cggcauauacac  c gu ga ggauu g
   -     a     g            ua a  -  -     g 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 80161824-80161904 [-]
sense
ENSSSCT00000016693 ; CALCR-201; intron 1
ENSSSCT00000020326 ; ssc-mir-489.1-201; exon 1
Database links

Mature sequence ssc-miR-489

Accession MIMAT0025375
Sequence

50 - 

agugacaucacauauacggcgg

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).