Stem-loop sequence ssc-mir-3613

AccessionMI0022161 (change log)
DescriptionSus scrofa miR-3613 stem-loop
Gene family MIPF0001411; mir-3613
Literature search

2 open access papers mention ssc-mir-3613
(2 sentences)

Stem-loop
   g   u    uu    ua               g ugc 
5'  ggu ugga  guug  cuuuuuuuuuuguuc u   a
    ||| ||||  ||||  ||||||||||||||| |   u
3'  cca acuu  caac  gaaaaaaaaaacaag a   u
   g   c    cc    cc               g uuu 
Get sequence
Deep sequencing
2375 reads, 307 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-3613

Accession MIMAT0025387
Sequence

11 - 

uguuguacuuuuuuuuuugu

 - 30

Get sequence
Deep sequencing2352 reads, 15 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).