Stem-loop sequence ssc-mir-2366-2

AccessionMI0022163 (change log)
DescriptionSus scrofa miR-2366-2 stem-loop
Gene family MIPF0001403; mir-2366
Literature search

3 open access papers mention ssc-mir-2366-2
(3 sentences)

Stem-loop
   gc    g    a  gu     ug    a c     aaa agg 
5'   ccug cccc gg  ccucu  ucug g cccag   g   a
     |||| |||| ||  |||||  |||| | |||||   |   g
3'   ggac gggg uc  ggaga  agac c ggguc   c   a
   uu    a    g  ug     --    a u     --g gag 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 142822087-142822169 [+]
sense
Database links

Mature sequence ssc-miR-2366

Accession MIMAT0025388
Sequence

52 - 

ugggucacagaagagggucugg

 - 73

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).